NOTE:
Each small RNA sequence must start with a greater-than symbol (">") in the first column. The words right after the ">" symbol in the single initial line are optional and only used for the purpose of identification and description.

>u156994_piRNA_house mouse
TNGGAACAGACTATTTCTCTAGAGTGCCTT
>u159238_piRNA_house mouse
TGTGAGGTCCAGGGGCTCGATCCTCAGC
>u54040_piRNA_house mouse
TGGATTGTGGATGTACCACAGGGCTGGCT
>u83118_piRNA_house mouse
TGATTAACCGATGTGCCCAAGCCGTAAC
>u59468_piRNA_house mouse
TCTCATGGTGTGAATCGCTTTTCAATC
>u163526_piRNA_house mouse
TGGAGACAATGAACAGGGGGCTGTTGTA
>u73673_piRNA_house mouse
TGAATGAACCAATTCTAATTTTGAAACCTTT
>u49486_piRNA_house mouse
TGCCCAAAGAGCAAATCTCAGCCTCACC
>u147967_piRNA_house mouse
TCAAACCATCTTAATGACCTCATCTCACAA
>u51809_piRNA_house mouse
GACTTGAGATGGACTTCTGTACAGTGGC
>u170800_piRNA_house mouse
TGAATCTTGCTGTGTGTACTTACAACCTC
>u169972_piRNA_house mouse
TGACTGTTCTGGATGGCTCTTGTTCCTA
>u53642_piRNA_house mouse
TAGCAGTTTAACCCGATAAGTTAACC
>u149167_piRNA_house mouse
TAGTGTCGTACATTTAGCACCCGTGATGC
>u74363_piRNA_house mouse
TAAATGAGATCTTGTCTCTAAAAAATAAA
>u171617_piRNA_house mouse
TGAAAGAATGAACTGCCAGACTGACTGCCC
>u156403_piRNA_house mouse
TNTCACAGCAACAGAAAGGAAACTAGGAA
>u161967_piRNA_house mouse
TGGGATGAGGTGGTACGGAATCAATGGT
>u62268_piRNA_house mouse
TGGAATACCCTCTTTATTGATTAGTTAC
>u147190_piRNA_house mouse
TCAGGTTTAATACGTGTTGCCTTTTGCC
>u66964_piRNA_house mouse
TGAATGCTGGGTAAAGTCCCAGTG
>u84737_piRNA_house mouse
TGCCTTAAGTTGTGTAGCTATCCTCTT
>u79837_piRNA_house mouse
TGCCTTAGGAAAGAATTGAGATTTCTCTCT
>u82176_piRNA_house mouse
TGCGCTACAGTTCCTGGTCTCTCCT
>u165109_piRNA_house mouse
TGGAAANTGCCTGACTACTTGCCTATCCT
>u84537_piRNA_house mouse
TGGGTCAGCATCAACCACAACATAGCAG
>u153586_piRNA_house mouse
TAAGACTCAAGTTTGGTGCTGCCTCCCGT
>u151210_piRNA_house mouse
TAGAAACTGCCTGGTGCAGATGCCATGT
>u82696_piRNA_house mouse
TCAGTAACTAAGACTATGTATGCCTTGC
>u61491_piRNA_house mouse
TAAAAAGTCTGAGAAAGAAATTGCAGGA
>u51890_piRNA_house mouse
TGCCAGCAAATGACCAATCTCAACTGTAGA
>u78906_piRNA_house mouse
TGTGGACCTGCTCTGTGCTTCTGCGCTCTC
>u171084_piRNA_house mouse
TGAAGATGCTGAGATTGAACCTGAGGCAGT
>u86918_piRNA_house mouse
TGAGACCATAACAGTGGCTGCAACCTTT
>u58347_piRNA_house mouse
TAGGGAAACAAGCAATACAAATTAAAAG
>u159316_piRNA_house mouse
TGTGACGGAGATCATGCGGTGCCCGGACAT
>u62690_piRNA_house mouse
GGCATATCCATAGATGAATGCTGGGTAAA
>u81232_piRNA_house mouse
TGGTAATGAGCCGGAGATAGTCTGGAG
>u175008_piRNA_house mouse
GGCTAGTCAGTTTTAGTGCCCCAAATGATC
>u78812_piRNA_house mouse
TGTCATCTTTCTAAGCATGCATATTTTTAA
>u87423_piRNA_house mouse
TAGAAAATGAATGTCAACAGAGATGG
>u170665_piRNA_house mouse
TGAATTTTCCAGTAGTGACGCCTCTTTCA
>u68412_piRNA_house mouse
TGACCCTGGTGACTGAAGCGAAGTTTC
>u164340_piRNA_house mouse
TAAAGCCTTGAACTGGAATTGACAAT
>u167294_piRNA_house mouse
TGCATGGTGAACTTTCCTCCTAAACTCCGGT
>u47625_piRNA_house mouse
TACTAGGGATCCTGTTAAAACAGGAGTGTG
>u173179_piRNA_house mouse
TCGAACTCAGAAATCCACTGCCTCTGCCT
>u86031_piRNA_house mouse
TCCTGGGACTTAAAACAGAGATTTGTCTCAG
>u65400_piRNA_house mouse
TGGACAGCTGACATGGAAGAACTCGGA
>u46397_piRNA_house mouse
TAAATAAACTGTGTGAAAGAGAAAAG
>u51870_piRNA_house mouse
TGGGAGCTCGATTAAGTGAAAGTCAG
>u174475_piRNA_house mouse
TCCAGGTCACTGCTGATGTGAAGATGAG
>u160152_piRNA_house mouse
TGTAAACACAGGGACTAAGAGATAAATAAGC
>u75307_piRNA_house mouse
TGATTGTAACCTGAATGGTAGCTTCCTT
>u66832_piRNA_house mouse
TGACAGCATGCTGCTTTATGATGGAT
>u157519_piRNA_house mouse
TNGAAGGGCCAAAGGCTAAAATTGCTACAACC
>u157855_piRNA_house mouse
TNCCATTAGCACTTCAGGAATGCCATAA
>u75925_piRNA_house mouse
TGGACAATTTATTTTGGTGACAATATTGGA
>u153389_piRNA_house mouse
TAAGCTTGAATGTTGGTGATCCATGGACCTA
>u49843_piRNA_house mouse
TAATTACAGTTGACATTTCCATCGGTGAGACC
>u84461_piRNA_house mouse
TAGCTCAAATAGTTTGCTAGAGATCAGCTT
>u148310_piRNA_house mouse
TATTAAAGTTCCTGGTCTGTCCTAACATG
>u172316_piRNA_house mouse
TCTGAGGACCTCCGAGACTTTGATTGCGAA
>u70486_piRNA_house mouse
TGCACAGTTTAAGGTAATGGAGCACACGCT
>u170506_piRNA_house mouse
TGACACTGGTGCCGGGTCTGCTGTGA
>u62787_piRNA_house mouse
TGGGTTTCTTTTTGAAATGCATGGTTGGC
>u52422_piRNA_house mouse
TACATAAGTACATCTCAAAGTGTGTGTGTA
>u163337_piRNA_house mouse
TGGATATATCTGTCCATTGCCTGATACC
>u65264_piRNA_house mouse
ACCCTGGTGATTTGAGTCTCGCATTTCCAGC
>u81784_piRNA_house mouse
TAGAATTTCCGGTCTGGTCACACTCA
>u77139_piRNA_house mouse
TGGATCTTCCATATTTAACTTTGCATAGCCA
>u156157_piRNA_house mouse
TTAAACAAATGTTCTTTTTAGGTCCATAAT
>u61463_piRNA_house mouse
TCCAATTGCCTTGGTCTCTGCCTCCCCA
>u53807_piRNA_house mouse
TACAATCAATGGGACCTACTCATGGG
>u62141_piRNA_house mouse
TGATCTGGTGCAGGAGATTCTGTTGT
>u155684_piRNA_house mouse
TTCACTTTATACTGTGGGTTTCCTGGAC
>u173006_piRNA_house mouse
TCGGTCAGTCTATTGGCTTAGGTGCTTC
>u166265_piRNA_house mouse
TGCCTGCATATTGTTTCTATGTGGCCTTGA
>u79803_piRNA_house mouse
ACAAAAAACCTCGGGGTGTCTGGTATAA
>u163127_piRNA_house mouse
TGGCAAACTGAGGTGTTACTAACATTGTCTT
>u67943_piRNA_house mouse
ATGGTGATCCAAGTGAGCAAAGAGAAC
>u87725_piRNA_house mouse
TGGCATGGATCAAATACTTCTCACTCTCGA
>u49944_piRNA_house mouse
GACAATCGTTTTCTTTTATGTGTTTTATGGT
>u87340_piRNA_house mouse
TGGCAAAAGCACACCCCTGCTAG
>u149517_piRNA_house mouse
TAGGTGTCTCCTTCCCATCTCAACGGAAAG
>u67813_piRNA_house mouse
TTGAAAGTCAAAATTCCCAAGCCGGTGACC
>u59401_piRNA_house mouse
TCCTGAGATGGGAAAAGGAGGTAGCGTTA
>u160208_piRNA_house mouse
TGTAAAAATGAGACAGTGGTGTTCCCAAGG
>u65154_piRNA_house mouse
TGGTGTCCCAAAACTATATAAATGTTTTTT
>u161789_piRNA_house mouse
TGGGCCATTGAGACTTTTCATATTTCTACT
>u160717_piRNA_house mouse
TGGTGTCACTCTGTACTATCGTTATTCC
>u149275_piRNA_house mouse
TAGTCTGAAGGAAAACGGAACGGTGCTT
>u166688_piRNA_house mouse
TGCCATGGCTCTGAAACACAGACCACCTAT
>u87154_piRNA_house mouse
TCATTGGGTGCCTGTCCTGATGA
>u75279_piRNA_house mouse
TGTGGAATAGATATGGATGGTGATCCTGC
>u172243_piRNA_house mouse
TCTGCATGCCCACACCCTACACACACTCC
>u65153_piRNA_house mouse
TTGTGGCCAAATCGTGCATGCGCACCT
>u165427_piRNA_house mouse
TGCTTCAAGAACAGGATGATGCGGAGGCC
>u167350_piRNA_house mouse
TGCATCCACTTCCCTGTTTCCCCTCAGAAAT
>u72455_piRNA_house mouse
TGGTACTAGGTAGGATTTGCCAGCACAGC
>u54288_piRNA_house mouse
TGGAAGGCAAAGACGGAAAACAAATGCGCCT
>u66232_piRNA_house mouse
TCCAAAAAGCAAAGGTTTTTTCCTACCCCC
>u164490_piRNA_house mouse
TAAACAGCCTATGGAATTCTTTCTCTGGTA
>u55005_piRNA_house mouse
ATATATAGGTGCATATTGCTTGATGG
>u169109_piRNA_house mouse
TGAGGTCCCTTATGCTCAAGCTATGCCT
>u56446_piRNA_house mouse
TGCCAGTATCAAGTCATGTGAAGACATGAT
>u168935_piRNA_house mouse
TGAGTGCTGAGATTGCATGTGCACATC
>u153066_piRNA_house mouse
TAATATAAAACTGAAGTTGCTTCTTGTA
>u74520_piRNA_house mouse
TGGCCACATGAGGCATCTAGCGTGTC
>u55832_piRNA_house mouse
TGAATGACTACTATTGCTAAGAAAGCTTA
>u167048_piRNA_house mouse
TGCCAAGTGCCCTGAGACAAGAGTTCCCTCT
>u166799_piRNA_house mouse
TGCCAGGTTCCGGAGTGTTTCTCTTTATGC
>u81397_piRNA_house mouse
TGGTTCATCTATTGACAACAGTCTGTTGT
>u54477_piRNA_house mouse
TGAGTGTATTGAGATTCAATCTGGTTAGTCTC
>u167087_piRNA_house mouse
TGCCAAGATTTTCAGCTTGCCTGCC
>u171207_piRNA_house mouse
TGAACTTCTGATCCTTTTGCCTCCACCGC
>u146869_piRNA_house mouse
TCCAAAGGTACAGAGTTGAAGTGGGTGTC
>u54471_piRNA_house mouse
ACAGCAATGTGGAAGTGTA
>u80081_piRNA_house mouse
TAATAACCGGGCCTCTGAGCAGGTGCAGTG
>u55551_piRNA_house mouse
CAACACATTACAGTACATGTGATGTGAAA
>u63649_piRNA_house mouse
TGGCAATTCATTTAGCCATCTGCTTCTCT
>u151758_piRNA_house mouse
TACCTGGGCAGGGTGCCAGTTACCTTGGGT
>u147272_piRNA_house mouse
TCAGATGTCCCTACTAACTTGATGGCGATGA
>u174239_piRNA_house mouse
TCCCACGATCACTCCAAAGCAGTCATGGC
>u174866_piRNA_house mouse
TCCAAATTTTGGCTCCTATGTGCTGGTCCT
>u85215_piRNA_house mouse
TGTACTAGCTTTGTTGCTTTGTGCCTCCAC
>u69043_piRNA_house mouse
TCCCTGTGTTTGTGTGTGTAATGATGG
>u52996_piRNA_house mouse
TCACTTCAGTTGAAATGATCACTCTACC
>u164799_piRNA_house mouse
TAAAAACAGGTGATCTACCGTACCTTAAGTG
>u167372_piRNA_house mouse
TGCATATTGAAATGTTCTGGAACCTCGGT
>u155248_piRNA_house mouse
TTCTCTGAGTTCCAACATTCCTTCAGACA
>u73452_piRNA_house mouse
TGGATGGTGAGCTAGGAAAGCTACCTGG
>u64485_piRNA_house mouse
TGATGGATTTTAGATGAAAAAACTGTGA
>u76258_piRNA_house mouse
TAAAACAAAAACCTTCTTATATTTCTGTGTTT
>u67370_piRNA_house mouse
TGATTTCTGAAGTAAGGAAGGCTAAAC
>u62833_piRNA_house mouse
TACTAAGTGCAGCGCCTCATTTGAGT
>u162704_piRNA_house mouse
TGGCCTATCCTAACATGACTTCAAAGACCAG
>u85223_piRNA_house mouse
TGCTATTTGCTTAGGGCAGGCACCGG
>u162260_piRNA_house mouse
TGGGAAGGGTAGAGACTGGCCACATGA
>u170854_piRNA_house mouse
TGAATACATCACTGAGCTAGATAATTTGT
>u70821_piRNA_house mouse
TAGCAGGAACAAACGACATCAGCGAAGGTGT
>u154479_piRNA_house mouse
TTGTAACTTTCCTTATAGGGATGCCTCCGCT
>u88119_piRNA_house mouse
TGCTTTGGTGCCGGGTTTCCCCCA
>u48916_piRNA_house mouse
TGTTATAAATCCCTGCCTGGTGCTC
>u54750_piRNA_house mouse
TAAGAGGATGAAGGATGAGCATCCTGCCGGG
>u65720_piRNA_house mouse
TTGGAAATGATGCTGTTAACTTGGTAGCTA
>u171310_piRNA_house mouse
TGAACCAGTTCTTGGATGCTCTCTAACGGT
>u55894_piRNA_house mouse
TAATGTGTGTAATTCCTTCAGCCAGGGAGGT
>u50582_piRNA_house mouse
TAGGATAAGGCCCCTCAGCTACTGGCA
>u84265_piRNA_house mouse
TTCCTTTACAGATAGTCATGAGCCATCAT
>u165470_piRNA_house mouse
TGCTTAAGGTAGTTTTCAGGAGTTACACG
>u73217_piRNA_house mouse
TGTGTAAGAGTCACTCAGGTGGTAC
>u54469_piRNA_house mouse
TGCTTAGTAGGGACACAAAACTGTGCATAGCA
>u78439_piRNA_house mouse
TGTGTTTTCTAAACAGGTGACTACTGAA
>u76848_piRNA_house mouse
TCATCTACCTTAACTAACAGCTGTGCCT
>u165452_piRNA_house mouse
TGCTTAGATGTCAATGTGCCTTATTCATG
>u157718_piRNA_house mouse
TNCTAGTTTATCTTGTTTCAGGGATG
>u164998_piRNA_house mouse
TGGAAGAACTCTTTTCTGAACTGGATGCT
>u82378_piRNA_house mouse
GCCAAGGACGCTAGACTTTCAGAGCACTGT
>u56353_piRNA_house mouse
TCACTATCCTGGTGCACTGAGGCACAGA
>u67325_piRNA_house mouse
TTGCCAAAAAGCATACACTGAAGTCCT
>u54922_piRNA_house mouse
TGCCATAAGGTGTTTGCTGAGTTTGTTACC
>u149118_piRNA_house mouse
TAGTTGAAGGGGTGCGCTCACATTCATCT
>u162249_piRNA_house mouse
TGGGAAGTTTCCCGCACACAGACCTGTAC
>u67699_piRNA_house mouse
TGGTGCACAGCTTCTGGATTTGGCTC
>u159616_piRNA_house mouse
TGTCATTCTGGCCACAAAATCTGAGAAGGAC
>u65414_piRNA_house mouse
TGGAATGTCTTTGAGGTTAGTTTATACT
>u63336_piRNA_house mouse
TTTAATGTAAGAGAAGAATATATGTATCTG
>u63356_piRNA_house mouse
TAATTTGATGTAAGTCACAGACTCTCTTGT
>u175053_piRNA_house mouse
GGAGACAGGTGAGATGGCTGCCATGGT
>u66406_piRNA_house mouse
TACCAGATCTCTGTCGGCAAGCACTTC
>u171288_piRNA_house mouse
TGAACCTGACATTTGATGCCATCTCCACC
>u169646_piRNA_house mouse
TGAGAGATGATCTACATGTGCCACGTCCAA
>u69605_piRNA_house mouse
TATGAATAATGGTGGTCTTTCTTGG
>u176778_piRNA_house mouse
ACATCGAAACTTGCCTCTTCCCCTGGGTGT
>u169356_piRNA_house mouse
TGAGCCTGTTTATTTTCAGAGGTCTAGGA
>u62231_piRNA_house mouse
TGTTGAAGCCATTCATTCTTGAGATGATT
>u45732_piRNA_house mouse
TAGCTAAGTACACTTGATAGAGAAGCA
>u59210_piRNA_house mouse
TGCTTGTAATGTAGCTGAGGATGGCCT
>u62601_piRNA_house mouse
TAAACTCAAATGAGGATCCCTCATCAGTGTA
>u158568_piRNA_house mouse
TGTTATGTTTCTGAGCCCTACCTACCGC
>u80261_piRNA_house mouse
TACTACTAGATGGACCTGCTTGGATGTTACTC
>u164197_piRNA_house mouse
TAAATCAAGATGAAGTTCATGCCAAGCCTG
>u165580_piRNA_house mouse
TGCTGGAGCCAACACCTTGTGCCATGCC
>u71501_piRNA_house mouse
TTAAAATGCCATGGAGTGCTAGCCTTTGT
>u49473_piRNA_house mouse
TGGGGACCATATGTCATGAAGATTG
>u70718_piRNA_house mouse
TGAATGAGATGACTCTGTGGTGGGCCATGC
>u56185_piRNA_house mouse
ACTTGGACTGGTGTAGGAATTTCCTAG
>u173822_piRNA_house mouse
TCCGGGTGAGCCTGAAAGTGCACCGATTT
>u79749_piRNA_house mouse
TTCAAAGACTATTGTAGACATGAGGATGGT
>u68610_piRNA_house mouse
TATTATTATTAATTTATTATTTAGAGTCTCC
>u155004_piRNA_house mouse
TTGATCCTTTCACCTTCGCCTTTACACTGC
>u166600_piRNA_house mouse
TGCCCAAATACTACGGCGTCTGGTCCCCTCC
>u87427_piRNA_house mouse
TGGCTCAATTTCTCTCCCAAGCTTTAGGA
>u80945_piRNA_house mouse
TAGAAACTTGCATGGTTGCAAAGTCAGGGG
>u48841_piRNA_house mouse
TCAGAAGTGTGTTGAGAACAAGGCCC
>u62164_piRNA_house mouse
TGGCTACGTTAGCCACAGATGGCTTTAATTC
>u51546_piRNA_house mouse
TATTTTGGTTATTGATGTGAGCATCAAGGA
>u72997_piRNA_house mouse
AGCCAAAAGACAAGAAGACCAAAACCCAAA
>u166795_piRNA_house mouse
TGCCAGTCCAGAAAACTTGGAGATGTGCA
>u147213_piRNA_house mouse
TCAGGATGAAGTGTAAACTCCTCCATGGG
>u161503_piRNA_house mouse
TGGGTGCTTGCTGTTTACAGGGACTATTA
>u152498_piRNA_house mouse
TACAATGGTGTCTAAGACGAATTAGCCT
>u150018_piRNA_house mouse
TAGGAGAGCTGGGGAGATGCAGCGGTTGT
>u165364_piRNA_house mouse
TGCTTGCCAGGCCCTTGGTACTAACAC
>u63736_piRNA_house mouse
TGTGTTTGAATACTTGGTTCCCACTGGTGGC
>u56908_piRNA_house mouse
TGCACAACCTCTTAACCTCCCACTC
>u69291_piRNA_house mouse
TCCACTCAAGAGTATGAAAGGATTATGGCA
>u163021_piRNA_house mouse
TGGCACAGTGTTCTAAGGCCTTCAGGGTGT
>u64599_piRNA_house mouse
TATACAAAATTCGAGGTGCATCAGTTC
>u57424_piRNA_house mouse
TAGGTCTCCAGAGATTCTTATTTTGTGGC
>u62047_piRNA_house mouse
TCCAGTTGGTAGACGATGCTGGACGTGAC
>u164942_piRNA_house mouse
TGGAAGCCTAGCCAGAGTTCTGGAACATG
>u79194_piRNA_house mouse
TCAACTCTTAATATAGACCCTGCACAGCCTG
>u170864_piRNA_house mouse
TGAATAAGACATTGGAGAGTGCCTGGATA
>u63518_piRNA_house mouse
AGAAGATTCTGGTCTGTGGTGTTCTT
>u58154_piRNA_house mouse
TGAGTTGAGATAGACAAAAGCTGGCA
>u150002_piRNA_house mouse
TAGGAGCACAAAACAAAACGGAGGTCACAGC
>u165783_piRNA_house mouse
TGCTCAGCCATGGCTTACAATGTCTCTTT
>u63082_piRNA_house mouse
TGCCAGAGCATATCCAAGATGCACCCC
>u72792_piRNA_house mouse
TGAGCTACTTTTCCTGCATAGTGCTTA
>u53016_piRNA_house mouse
TCCCTTCAAAACAGGCATTCCCAAAAGA
>u167796_piRNA_house mouse
TGCAATGAGACTAGCCTCGTGGGGTGCAAT
>u155598_piRNA_house mouse
TTCCAAAGGTGGTTTTCTACAGATTGGT
>u155261_piRNA_house mouse
TTCTCCGTTGAGTTTTGCCTTGGCTTCCTT
>u71144_piRNA_house mouse
TAGGAGTCCTTTGGTTGCAACAAAAGA
>u61560_piRNA_house mouse
GGAACTATGGTCACTGCCTC
>u73013_piRNA_house mouse
TAAATCTAGCCAGTTCTGGTGTCCTTCAC
>u85732_piRNA_house mouse
TGCTAAGCTTCCAGGAATTTTGCATTCCC
>u83106_piRNA_house mouse
TGGGTAAGTCATTTGCCCTCTTTGGACCT
>u171404_piRNA_house mouse
TGAAATGTGCCGAGAGTCTGCGTATTCTTG
>u75210_piRNA_house mouse
GCCATTGGATGTTAAGTTCTTGTCCTAAA
>u152586_piRNA_house mouse
TACAAGGTCTTCAGAATAAGCCTCTCTTC
>u55372_piRNA_house mouse
TAGAAAGTATCTGAAATAGTTCTTGTTCTT
>u78249_piRNA_house mouse
TGCCCTGAGCATGTTGATCTCTTTGTGCCC
>u80703_piRNA_house mouse
TAGACAGCAGGAGAAAAGGAAACTTA
>u51107_piRNA_house mouse
GAAACATGTTGATGGCCACTGTCTTTCATTT
>u168469_piRNA_house mouse
TGATGCAGATAACGTTTGGTGTTGCAACGT
>u84723_piRNA_house mouse
TGCCATTACCAAATGTTCTCCTTTTGAGAC
>u61498_piRNA_house mouse
TAACTGCTTCAACAGAAAAGATGAGTC
>u81901_piRNA_house mouse
TCCAAGTCAGAAATTCCATAGAGAATGTCT
>u164640_piRNA_house mouse
TAAAAGATGAGGTCCATGGTGAATTACTGTT
>u70992_piRNA_house mouse
TCAGAGTCTTTGAAGAATCCACATTCA
>u168751_piRNA_house mouse
TGATACATGTTAAGGGCATATGTGGACGGT
>u77988_piRNA_house mouse
TGATGCAAGATAAAAGTGAATTAAAATGGG
>u55816_piRNA_house mouse
TAGGAGAATTAGGTAGCAATCTATG
>u84212_piRNA_house mouse
GAAAGCTGATTCACCTGACATGCTAAGGAGA
>u162713_piRNA_house mouse
TGGCCTAGGAATGTCGGTACAGCCAGATG
>u155211_piRNA_house mouse
TTCTGGTCCATTTTAAAGCTGGTGAATCAGGT
>u52650_piRNA_house mouse
TGACAAATGTTCATTCTAGTGGCATTGTGA
>u148844_piRNA_house mouse
TATCAACCTCAAAGTTTCAGGTTTCATTAGT
>u170858_piRNA_house mouse
TGAATAAGGTGTTGCTGAAGTTGTCGGGCC
>u54897_piRNA_house mouse
TTCTCCCTTTCAGAAGAATTTTAACTGCTAC
>u48668_piRNA_house mouse
TAGCAATGAAGTTATTCAACAGTGATGT
>u78329_piRNA_house mouse
TGTGATTTAATTTTGAATCTCTGCGTAATA
>u156019_piRNA_house mouse
TTACATGGATTTAGCCTATGGTGAGCAGCC
>u163618_piRNA_house mouse
TGGACTATTCGAATGGAGGTGCTCTCTTCAT
>u172131_piRNA_house mouse
TCTGTCTGTCTGGCAAACCTGAACATGCCC
>u151644_piRNA_house mouse
TACGCAGCAAGAGATAACTGATGCAATCC
>u81010_piRNA_house mouse
TGGAAGAACTCTTTTCTGAACTGGATGC
>u169781_piRNA_house mouse
TGAGAAGTGTCCGTGACAGAGCCAGT
>u164463_piRNA_house mouse
TAAACCCAGACAGAATATGCCAAGCTGA
>u72753_piRNA_house mouse
TACTAGATGCAAGAGTTTGTGGAACAGTCT
>u79845_piRNA_house mouse
TGATGTTGACTTCGCTACTAATAAAGGA
>u171953_piRNA_house mouse
TCTTGGTGTTAACTTAAAAATGTCGAGTTC
>u162693_piRNA_house mouse
TGGCCTCAGGTCCCTGGGATGGTATTTGG
>u150616_piRNA_house mouse
TAGCAAATACGATGACGGCCATGGTCTGC
>u50335_piRNA_house mouse
TAGAATGGATTTATCTATCAGGACCCAGAG
>u147188_piRNA_house mouse
TCAGGTTTGTGTCTCGGCTTGCACTTT
>u149339_piRNA_house mouse
TAGTATGTTTAGGTATGACCCTCATGTGT
>u152719_piRNA_house mouse
TACAAAGACACTCTCATGAATCTAAGGATGCC
>u64984_piRNA_house mouse
TAAGACTTTGGTTTAAATGTCGCTGTTTC
>u80513_piRNA_house mouse
ACAGCACTGTAATGATAGGCTAGC
>u79904_piRNA_house mouse
AGGGAAAGATTAATGCCTACCTTATCAATG
>u173124_piRNA_house mouse
TCGAGAGTGTCCTTCTGATGAATGTGGTC
>u72878_piRNA_house mouse
TATTCAACATTGAGTCTCTGGACCGCCAC
>u86586_piRNA_house mouse
TAAAATTCTGGCTAGCTGGGCCCTCAC
>u87415_piRNA_house mouse
TGGGTACCACACAGTGTCATTACGTAA
>u81307_piRNA_house mouse
TGGAGAATACTAAGGAATCTCAGGGA
>u56957_piRNA_house mouse
TGTGTAAGAAATGCATTTATGTCCAAGAG
>u149645_piRNA_house mouse
TAGGTCACACATTCCAGGCTCTGACACAAC
>u54329_piRNA_house mouse
TCCTGGAGAAGGTATTGATACAGGTGGTC
>u155335_piRNA_house mouse
TTCNGAATGATAGATTGCCTTGGAACTGC
>u47920_piRNA_house mouse
GCTTTAAACATGGATGTACTCCAGATAGC
>u154412_piRNA_house mouse
TTGTCCTGCTGGTCAGATGAGATGGGATT
>u79966_piRNA_house mouse
TGGGATTATAAGACTGCCCATTATGCCTG
>u59086_piRNA_house mouse
TATTCTATGGTGTTCTGTCACCCGACAGTCTC
>u58193_piRNA_house mouse
TCACAGTGTTTGCAAAGCTGGAACCGTC
>u158921_piRNA_house mouse
TGTGGCTGTCTTTACTTTTGCCTTCAGGGA
>u165340_piRNA_house mouse
TGCTTGTATGTATATGTTTTCAGAGTTAACC
>u85877_piRNA_house mouse
TAAGTTCATATATGCAACAGTCATGTCTA
>u174941_piRNA_house mouse
GNGGACAGTTAGCCATCAAGGTGTT
>u83861_piRNA_house mouse
TGGGTAACTTGTGCCTGAAGGATGATGAC
>u48387_piRNA_house mouse
TAGGTGTGCAATGTTTGTACCCATCC
>u147231_piRNA_house mouse
TCAGCTGGTGACCTCATTTCTATTCAGTCT
>u63163_piRNA_house mouse
TAACAAACCTGGGACACACCTTTGCCCTGC
>u78131_piRNA_house mouse
ACGGTATCTATGGCTACCCAGTGTCTT
>u169322_piRNA_house mouse
TGAGCTCCCTGCTAGGTGTGGATGGT
>u75198_piRNA_house mouse
GTGGACATGATAGATTTATGCTGAGAAGA
>u171660_piRNA_house mouse
TGAAACGTGAAAGTGGAATCTTTGAACTCT
>u85448_piRNA_house mouse
TGATATTGTTGACTGCATTTAGGAGGATTC
>u160744_piRNA_house mouse
TGGTGGCTGCCAGGATACAATGGTGTCTAA
>u175776_piRNA_house mouse
CGTTTGACTCTGGATATCTTAGCATTC
>u150783_piRNA_house mouse
TAGAGGTTGCCGTTCTTGCCGTTAGGGCTA
>u73479_piRNA_house mouse
TGGAAATTGATCGGATGCTCCATCGGCT
>u66810_piRNA_house mouse
TAAAATTGAAGCGGTGCTTCTGTTGGTTCC
>u151401_piRNA_house mouse
TACTGGGTGAGTGTCATGAATGGTGGA
>u75743_piRNA_house mouse
TAGTGCTCTGTTACGGAAAGTTCGCTGT
>u46617_piRNA_house mouse
TTTTTAAAAAGATGATTTACAAATGGCCA
>u157688_piRNA_house mouse
TNCTCTTTGCAAGTTGCTTCCTACATGTGT
>u59320_piRNA_house mouse
TAGGAAGACCCAGACTCACTGGACAGATGG
>u85491_piRNA_house mouse
TGACAGCATTGTCTTCTGAGTCAGC
>u71211_piRNA_house mouse
TTATTATGTGTGTACCCATGTGGATGTGT
>u63429_piRNA_house mouse
TGATTCAAGCGTTCTCTCAACCTGGC
>u64619_piRNA_house mouse
TACAAGTACTACTTATCATTCTCCTCCATA
>u66785_piRNA_house mouse
GGCATTCTTTTTGCATGTTGGTA
>u57046_piRNA_house mouse
TGTGAGCATCTTGCCTGTTCGTGGGA
>u67960_piRNA_house mouse
TGGGAAAGCCACTACTTTCTCTTTTCTGAT
>u73619_piRNA_house mouse
TAAATTTTGCTGAATGATGTTTGTCGCCA
>u85203_piRNA_house mouse
TAGATTGGATGCCCTGAAGACAGACTTTGT
>u78840_piRNA_house mouse
AGAAAAAGGTGACCATAGCAGCTTCC
>u68634_piRNA_house mouse
TGGGATTAAAGGCACCACAGCAGGATCTTAT
>u63562_piRNA_house mouse
TGCAATGGTGCTTGTCTCTAGGGGTTACTCT
>u148740_piRNA_house mouse
TATCATTATGCCTTTTCTTCCCTACAGAT
>u174884_piRNA_house mouse
TCCAAAGGTGGTTTTCTACAGATTGGTGGT
>u86245_piRNA_house mouse
TGATTCATTCTGATACCTCTTGTAGTTGC
>u173341_piRNA_house mouse
TCCTGTCTTAGGGTTGCCATTCCTGTGT
>u73113_piRNA_house mouse
TATATATGAAATAGTGTTTCGATGTCTGTT
>u171115_piRNA_house mouse
TGAAGATAGGTGACTCAAAACATCTGTG
>u82123_piRNA_house mouse
ACGTGCATGAAGATAGGTGACTCAAA
>u162908_piRNA_house mouse
TGGCATATGGACTGTCTATTCTCAGCTTC
>u163227_piRNA_house mouse
TGGATNTATCACAGCTGCCTGAATGGCCTC
>u72267_piRNA_house mouse
TATGTATAAATAAAATAAGAACCTGGTAC
>u79221_piRNA_house mouse
TAGAATGTGATCAGGTTCTCCTGCCCGTGT
>u47662_piRNA_house mouse
TAGTTGATGTAGACCCTGAGAAAATG
>u173408_piRNA_house mouse
TCCTGCGATGTGTGCTTTGGATACTGTAC
>u73250_piRNA_house mouse
TAAATAATCTGTGCTTTCCAATGGTC
>u165550_piRNA_house mouse
TGCTGTAGTGTCCAGAACGCCTCAGGTCCG
>u70668_piRNA_house mouse
TGACAAATACCGGAACTCAGATGTTGCC
>u155657_piRNA_house mouse
TTCAGGACGTTCTGCCAGAATGACAACAGT
>u60139_piRNA_house mouse
TGTGTTAAAGGCTTTGTCCACAGGGTGGT
>u173315_piRNA_house mouse
TCCTTAAATCTTGTCCTGCCTACCAGCTG
>u52744_piRNA_house mouse
AGAGCACCCCATTGGCTACCCAC
>u156662_piRNA_house mouse
TNGGTTTTAGTTGCTAGATTGTGTGCTTA
>u52850_piRNA_house mouse
TACAAGTTAGTGTGGACCTACACTCCCAA
>u80767_piRNA_house mouse
TGACGTGCATGAATACTGAATTTCTTTTC
>u68992_piRNA_house mouse
TCCATGTGTATGTGATGTCTGCAATTTTA
>u52987_piRNA_house mouse
AGGAATGACATGAGGATCTGAGGACCT
>u76221_piRNA_house mouse
AACATGTGCGGTTTGGTAATTTGTGCCTTG
>u158238_piRNA_house mouse
TNCAAAGCTTAAATGCGTGGCTACTTTCAC
>u167075_piRNA_house mouse
TGCCAAGCCTTTGGTAACCTCAAGTACTA
>u62092_piRNA_house mouse
TAGACGCAGTCATCTGACTGGATGAAGAAT
>u48231_piRNA_house mouse
TGGGCAATAAGACTGGACACTTAAGCGTTTC
>u62843_piRNA_house mouse
TGGCTACTGCGCAGCTCTCTCACAACAC
>u88196_piRNA_house mouse
TGAAAAACTCAGCTGTACTGTAGAAGCCTT
>u55257_piRNA_house mouse
TAGTTCCCGACTCTCCTTGGAAATTGAT
>u170422_piRNA_house mouse
TGACAGGCGTTCAGTGCTACCGCTC
>u54206_piRNA_house mouse
TGGGACTTCCATTTTTAACCACGACACGG
>u74475_piRNA_house mouse
TAGCAGAACACTTTTGGTTTCATGTTTGTC
>u58302_piRNA_house mouse
TAGTAACTCACATGGACAACCCACTT
>u155431_piRNA_house mouse
TTCCTCAGCATCCTGATAGGTGATAGATC
>u147574_piRNA_house mouse
TCACATACAACACAGCCAAATCAAAGGATC
>u172170_piRNA_house mouse
TCTGGTGATACACTGGTTCCGCACATTAA
>u156457_piRNA_house mouse
TNTAAGTAAGCAGGCAGTGCATGGCGT
>u71943_piRNA_house mouse
AACAATGTCACATGGATGATGCCAAGTTC
>u169762_piRNA_house mouse
TGAGAATGAAGTGCCTCAACACTGTATC
>u86368_piRNA_house mouse
TGGAATTGTTAGACTTTTCTCTCTGGAGTC
>u159261_piRNA_house mouse
TGTGAGCATTTGGCAGATACTCATTGGA
>u86238_piRNA_house mouse
TAGACAGAGAAAATCTCAGTCATCTGGTAT
>u50544_piRNA_house mouse
TTCTTTAAGGTTTTCTGAAGATAATGTGG
>u162613_piRNA_house mouse
TGGCCTTTGTCAGGGTTTACACATCAGC
>u73984_piRNA_house mouse
TCGGCTGCACCGGTATTTTGCCGGCTGGTT
>u79767_piRNA_house mouse
TCCATGATTCACTGCTAATCGCTGCCATACC
>u147834_piRNA_house mouse
TCAACTGCGACTTTTTGTGTGTCCTGAGCCT
>u88248_piRNA_house mouse
TGGTGATACCCTTGTCTCCCCACCT
>u63994_piRNA_house mouse
TACAGCCTATCCTTTACCAAGTAAAGAACA
>u158499_piRNA_house mouse
TGTTCTGAAAAGAGAGGGACCTCCAGAGT
>u54376_piRNA_house mouse
TGTATGGTAAACTCATATCCTGGGGACAA
>u160552_piRNA_house mouse
TGGTTAGCCGAACTTCCTGCATGGAAGAGA
>u66480_piRNA_house mouse
TGTAATGTTGTAAAGATGGTTTCTGTGGTA
>u67369_piRNA_house mouse
TAAAACCCTAAGGCACTATCATTTCAAAAG
>u147826_piRNA_house mouse
TCAAGAAGGTGACAATGAGAACCACTCATTT
>u76454_piRNA_house mouse
TGCTATATTTGATAGTTGTTGGCCCC
>u167245_piRNA_house mouse
TGCATTTCTAGGGGATAGTCTCATAGG
>u167430_piRNA_house mouse
TGCAGTGTACCAGGATGGAGACAGAGGT
>u170523_piRNA_house mouse
TGACACTAGTGAATCTCGATGTGCCTGC
>u48449_piRNA_house mouse
TATCATCAGTGAGCACTGGCCGCAGC
>u86272_piRNA_house mouse
TGCTTTCTCGTTGTTTTGTATCCAGCCC
>u87004_piRNA_house mouse
TACAGTAGGATGTGAAGGCCACAAATAG
>u82020_piRNA_house mouse
TAAAAAGCGGGGCTGAGATGATTATTGTC
>u83884_piRNA_house mouse
TGCTGTGCCTGTCAGTCATCAGGTAC
>u69923_piRNA_house mouse
TAGGAAAGAATTGAGATTTCTCTCTTGGC
>u157113_piRNA_house mouse
TNGCTACCTTATAACTAGTCTTTTGGAGTTC
>u75951_piRNA_house mouse
TAGAAGCCTAAGATGATATACATATTATA
>u45908_piRNA_house mouse
TCCAAGGACATTGTCTACTTAATATG
>u151572_piRNA_house mouse
TACTAAAGGCTGCCTGCTACCATGTTCC
>u73123_piRNA_house mouse
TGCCAGCACACAGAAAAGAACGTGATA
>u86644_piRNA_house mouse
TAGTATTCTGTAGATTTCTAGCCTCCAGA
>u83019_piRNA_house mouse
TGACAAATGACAAGTTTTCTGGTGTCC
>u58873_piRNA_house mouse
TAGGTCATACCATGTCAGAAAAAAAATGGGC
>u155696_piRNA_house mouse
TTCACTTCATGGACTCCCTATGATCGTGA
>u85341_piRNA_house mouse
TCTACACCAGCCTACAGAGCGAGCACCTTCC
>u64860_piRNA_house mouse
TAAAAAGACAGTGGCTTCGTAAGGCCTCATT
>u52679_piRNA_house mouse
TAAGGCCCACAGCTCCAACAC
>u153666_piRNA_house mouse
TAAGAAAGTGACCTCAAAGTACACGGATGT
>u59377_piRNA_house mouse
TGAGTCCTAAAGCTCAGTTTGAGATGTGTC
>u149193_piRNA_house mouse
TAGTGGAAGAAAGGCCTGAATTCATTGCT
>u83695_piRNA_house mouse
TGGGTGTTGCTTCAATGGCAGTGTCTAGCCA
>u51867_piRNA_house mouse
TACTTGACTGGAAATCTGTCGAAAC
>u76943_piRNA_house mouse
TAACCTATTTTTATTCAACACAGGCCCTTGC
>u174383_piRNA_house mouse
TCCATCGGCTGCCACTAACCAAGACTC
>u64391_piRNA_house mouse
TACTCAACCAGTGCCATATATGCCTTGACA
>u167942_piRNA_house mouse
TGCAAGAGAGCTGGCATGCCTTCTGCCC
>u83409_piRNA_house mouse
TTCAATTCAGAATGTAGTTTGC
>u59764_piRNA_house mouse
TGACCGGAAAGTTGGCCTATTGTGCAGC
>u160857_piRNA_house mouse
TGGTGATCATTTGATAGAAATGTCTTTC
>u55285_piRNA_house mouse
TGCCTAAAATGCTGTTCCCAGTCCAG
>u156330_piRNA_house mouse
TNTGACAGGTTATTCCCAAAGTGCAAAGCAT
>u166351_piRNA_house mouse
TGCCTCCCGTAAAACTTCTATGATGCCAT
>u175534_piRNA_house mouse
CTTATTCTTCTGGTGCATGCTGGTGTCT
>u46125_piRNA_house mouse
TTCTAGATGTTCTTCTCACCATACCTCTTA
>u163738_piRNA_house mouse
TGGAATGGTGTCTCTGTGGCTGTCTTG
>u52008_piRNA_house mouse
CACTGTCTCTATTAGAAGTAAATTTGAATGT
>u48221_piRNA_house mouse
TCAAATGTTACAATGTGTCGCTGTCCTTC
>u82892_piRNA_house mouse
TGGTGTAAGTTTGAGAACTCTGGGC
>u59839_piRNA_house mouse
TCCCAAAAAGTGTGTCTTGATATCAA
>u86819_piRNA_house mouse
TGAGTATTGACTGCCATTTTTCCCCCTCAC
>u148331_piRNA_house mouse
TATGTGTTATTGTGACCTTCAAGGATGC
>u77031_piRNA_house mouse
TTACATATCAGGGTCACCCCCTTGCTTTT
>u72680_piRNA_house mouse
TGGTGTTGTATCCATTATCACCTGCA
>u62328_piRNA_house mouse
CTCCATGCTTTTGAGTTGGCTTGCTTCCCCC
>u158368_piRNA_house mouse
TGTTTAAGAGAGCCGTAGACTTCATTAAATC
>u46903_piRNA_house mouse
TGGCCACCTCTGCAATCGCTGCTTTGGAAC
>u68808_piRNA_house mouse
TGGAAGTTTGGTGTAAAGAAGCAACAT
>u70865_piRNA_house mouse
TGAGCATTTTGATTTTTGATATTTCTAGCT
>u51170_piRNA_house mouse
TGGTAATGATGTTGACTCTTAGTGTT
>u175214_piRNA_house mouse
GCAGAATGGGATTTGCCTACCTCTTGTAAGT
>u75763_piRNA_house mouse
TAAGAGCAAATGAGAGTGAAAAGAATTGA
>u163699_piRNA_house mouse
TGGAATTTTGAATGTGTCTGTAGTGACTC
>u75045_piRNA_house mouse
TCCCATTTCTAAGAAAGGGTAAAGTGTGAC
>u76251_piRNA_house mouse
TTCCAAGGAATGAATCTTGAAACTTTGGA
>u173528_piRNA_house mouse
TCCTCCAAACTGTGTGCCTGCCCTGT
>u151933_piRNA_house mouse
TACCATAAGTTGGCAATCTGGGTGCCACAGC
>u158999_piRNA_house mouse
TGTGCTTCATTCTGTGGATCTGACATGCCT
>u54494_piRNA_house mouse
TGGTTGTCGGAAAGCATCTGAAAATGCGT
>u161134_piRNA_house mouse
TGGTATCACCCGACAACTTTAGTTGATTTC
>u147510_piRNA_house mouse
TCACCTAGCCGTGGAATGGTGTCTCTGT
>u152665_piRNA_house mouse
TACAAATGGTGGGCCTGATTTCGGGCAAGT
>u60367_piRNA_house mouse
TATTAGGAATATTCCAGGAAGCTTACTTTG
>u74752_piRNA_house mouse
TGTATAATTTCAGTAGTTCCACAGATGG
>u169876_piRNA_house mouse
TGAGAAAGAAATATGAGGCCACTGGTAC
>u49087_piRNA_house mouse
TGATTGAAAAAATATTCTAAGGAACACAAT
>u48893_piRNA_house mouse
TAATTCTATTGATCTGGTGCAGGAGA
>u80815_piRNA_house mouse
TACAAAGCTTAAATGCGTGGCTACTTTCAC
>u167016_piRNA_house mouse
TGCCAATGGAGGGCCATAGATTGGTGCTA
>u80356_piRNA_house mouse
TATTTATATTGATTTATTCCAGAGCCA
>u72067_piRNA_house mouse
TCCTAGTTAAAGAGTAGGCCTGGAAATCACC
>u61342_piRNA_house mouse
TGTTTCTAGCCTGAAGCTGCAGAGCCTCAA
>u67301_piRNA_house mouse
TCAGATGATCAGACCTTGTCACATAGG
>u149503_piRNA_house mouse
TAGGTGTGTGACCAATTTCCTAAGAGAAT
>u53210_piRNA_house mouse
TAGAAATCTCTTTGCCTGTGATGAGTTT
>u148937_piRNA_house mouse
TATACTCTAGGAACTTGTGCGGCCTCA
>u60566_piRNA_house mouse
TGACAATGACTACTACAACAGAAACCAGT
>u160460_piRNA_house mouse
TGGTTGGTGGCCGTGTGTGAGATGTGTTA
>u156951_piRNA_house mouse
TNGGACATTTCTTAATTAGTGCCTGATGG
>u51595_piRNA_house mouse
TGTTCAGACCGTGTTGAGGTGGTGAGA
>u82468_piRNA_house mouse
TGGAAATAAAATCCAATGTTTCGTGTC
>u56843_piRNA_house mouse
ACTAAAATAAAGCCTTGGATGCGTCAC
>u60521_piRNA_house mouse
ACAACAAAAATAATAGGAAGCAACAATTACTT
>u173976_piRNA_house mouse
TCCCTCTAAGAGTGTGCTCTCTAAACCCC
>u173432_piRNA_house mouse
TCCTGAGAGAACATTTCCCTGCCCTCAC
>u54237_piRNA_house mouse
TGCCCTGGGCGCCATGAACTACTAAGTCC
>u84011_piRNA_house mouse
TAGAAACAATAGAAATAATGTTGCTGCCTT
>u149605_piRNA_house mouse
TAGGTGACTCAAAGACATCTGTGCT
>u60467_piRNA_house mouse
TGAGGAATGAGGATGGTTCTAGAACCCATGC
>u70873_piRNA_house mouse
TCCTTTGTTTGATCCGGATGGAAACCATGG
>u155031_piRNA_house mouse
TTGAGCCTGGTCTCTCTTGCCTGGAGGTGT
>u156768_piRNA_house mouse
TNGGTCAGGAACTATGGACATGATCAGG
>u80576_piRNA_house mouse
TGCATTGCTTCTACAGCCCTCAGTGGTA
>u152554_piRNA_house mouse
TACAAGTGCTTTGCTGGTTCACACCGGGGTT
>u74488_piRNA_house mouse
TGTAAAATAAGACATTTGTAGGCTGGTGT
>u155150_piRNA_house mouse
TTCTTTGGTAGCCTCTCCACCTTTCTTGGCC
>u155955_piRNA_house mouse
TTAGATGAGTGGAAAGGTGCTGTGTGT
>u152418_piRNA_house mouse
TACACCCATATGGAAGGAACGAGGGTTGT
>u51255_piRNA_house mouse
TGCAATCCTTGACTTTCAGGAATTGTGCAT
>u46103_piRNA_house mouse
TAGAAAGTCCTCATCTTTTCTCTGC
>u171187_piRNA_house mouse
TGAAGAAAATGTCTCTCCCTACATGAGCAAC
>u66889_piRNA_house mouse
TATCGACAAAATTTGCCTGGGGCTTC
>u151251_piRNA_house mouse
TAGAAAACTCCAGATACATAGGTCCATGATC
>u71260_piRNA_house mouse
TCAGAGGTTTAGACGTGACTACCACTGC
>u166412_piRNA_house mouse
TGCCTATAGCATCATAAGACCTGTCGCC
>u168101_piRNA_house mouse
TGCAAAGGAGCCAGATGCCGTATCAGAA
>u46564_piRNA_house mouse
TGGGAACAGACTCATAGTACTTCTGAGGACC
>u148925_piRNA_house mouse
TATAGAGATGCCTACTATGTGCTATTTCCC
>u156104_piRNA_house mouse
TTAAGAACTACATGAATCTCTGAGGACTA
>u74455_piRNA_house mouse
TGCAGATGCTGCTGCTGTTGCCC
>u68676_piRNA_house mouse
TGTCGCTAAAGCTATGGTATCTCAGT
>u70421_piRNA_house mouse
TAATAATTATCGCTTGAAATTCATTCCCACAA
>u165633_piRNA_house mouse
TGCTGATGCCGCCTTTGAGTCCTTTCAGAGT
>u174815_piRNA_house mouse
TCCAAGGACATCTGACAGGGANTAGTAGA
Close